| Webpages from suppliers |
cellsignal --- ap ap 1 ap-1 ap1 cjun jun jun ser73 phosphate p p 05412 p 39 p-05412 p-39 p05412 p39 phosp ...
This antibody also recognizes JunD phosphorylated at Ser100. Source / Purification .. Polyclonal antibodies are produced by immunizing rabbits with a synthetic phospho-
www.cellsignal.com/products/9164.html more from same supplier |
novusbio --- anti-JunD FL isoform antibody
b>JunD is the most broadly expressed member of the Jun family and the AP1 transcription factor .. anti-JunD FL isoform antibody, anti-Transcription factor jun D antibody
www.novusbio.com/data_sheet/index/NB100-1859&prev_module=search more from same supplier |
systembio
Download Construct Sequence .. Transcription Response Element sequence: .. atgagtcagacgcatcagcat .. Transcription Response Element .. Plasmid .. Virus .. pGreenFire1- AP1 .. PA: Plasmid Price .. Virus Price
www.systembio.com/pGF_AP1.htm more from same supplier |
abmgood
M., et al. Crit. Rev. Eukaryot. Gene Expr. 4, 55, (1994) .. JunD >> Antibodies .. Anti-JunD antibody produced in rabbit
www.abmgood.com/ProdList-main.php?csn=8&ssn=106&dsn=78&catno=Y060550 more from same supplier |
abnova
b>JUND Pre-design Chimera RNAi .. Homo sapiens jun D proto-oncogene (JUND), mRNA.
www.abnova.com/Products/products_list.asp?classid=ABABAL000000&OwnClass=3&ClassL1=A&ClassL ... more from same supplier |
caltagmedsystems --- JunD (Ab-255) Antibody blocking peptide - Caltag Medsystems
Product Details JunD (Ab-255) Antibody blocking peptide .. Further information: JunD (Ab-255) Antibody Catalogue Numbers: 21028-1 and 21028-
www.caltagmedsystems.co.uk/pricing_ordering/product_detail.php?CI_ID=194296 more from same supplier |
openbiosystems
jund .. jund
www.openbiosystems.com/Query/index.html?q=JUND more from same supplier |
orbigen
two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. .. MEAI, SCG2, menin
www.orbigen.com/commerce/catalog/product.jsp?product_id=2049 more from same supplier |
panomics
b>JUND .. Jun D proto-oncogene
www.panomics.com/index.php?id=qgpsc&page=64 |
piercenet
Browse Product Catalog > Western Blotting, ELISA and Cell Imaging > Nucleic Acid .. LightShift Chemiluminescent EMSA Kit .. Excellent for detecting low-abundance proteins in nuclear extracts
www.piercenet.com/Products/Browse.cfm?fldID=06010701&wt.mc_id=eviewsVol_1_Iss_793i more from same supplier |