| Webpages from suppliers (information here can not be filtred).
|
novusbio --- Novus Bio: c-jun antibody Rabbit Polyclonal anti-c-jun
Genes Dev 2:1687-99 (1988). .. c-jun Related Products .. anti-AP1 antibody, anti-V-Jun antibody
www.novusbio.com/data_sheet/index/NB600-1482&prev_module=search more from same supplier |
cellsignal --- Phospho-c-Jun (Ser73) Antibody #9164
Product Pathways - MAPK Signaling Phospho-c-Jun (Ser73) Antibody #9164 .. Applications Key: W=Western Blotting IHC-P=Immunohistochemistry (Paraffin) IF-IC=
www.cellsignal.com/products/9164.html more from same supplier |
komabiotech
The stress-activated protein kinase 1 family is also referred to as the Jun N-terminal kinase family, in light of the substrate preference of these serine/ .. Anti-phospho-JNK (Thr183/Tyr185, Thr221/Tyr223)
www.komabiotech.co.kr/product/immunology/use/celsignal_05.htm |
biocat
c-Jun(Ab-63) Antibody for WB Reactivity: Human, Mouse, Rat .. 21001-1-SAB
www.biocat.de/cgi-bin/adm/sub2.pl?sub1=primary_antibodies&sub2=tumor_suppressors&prod_line ... more from same supplier |
panomics
AP-1 Reporter 293 Stable Cell Line .. Products Cellular Solutions AP1 293 AP-1 Reporter 293 Stable Cell Line .. AP1 background .. The activator protein 1 (AP-1) transcription factor is a dimeric complex that comprises members of the JUN, FOS,
www.panomics.com/product.php?product_id=52 more from same supplier |
orbigen
Baculo-EZ Expression-ready Full Length Clone Collection .. c-jun oncogene (Jun) .. 1 The JUN protein interacts with its partner protein FOS to form a heterodimer (AP1) which regulates the expression of a variety of genes.
www.orbigen.com/commerce/catalog/product.jsp?product_id=1116 more from same supplier |
caltagmedsystems
b>AP1 Cold Probe - (for TF ELISA) (25 uL) .. Product Code: EK0504
www.caltagmedsystems.co.uk/pricing_ordering/search_results.php?searchwords=&MF_ID=17&numre ... more from same supplier |
echelon
J., Olesen, L.E., Gallop, J.L., Butler, P.J., Evans, P.R. & McMahon, H.T. EpsinR: an AP1/clathrin interacting protein involved in vesicle trafficking. .. Jun, Y., Fratti, R.A. and Wickner, W.
www.echelon-inc.com/commerce/misc/byear.jsp |
biomyx
Human BRAF, Mouse MEKK1, Human P53, Human H-RAS, Human K-RAS2A, Human IkBa, Human c-Jun Purified Protein, Human N-RAS, Human K-RAS2B, Human JNK1, Human P38, Human AKT1 .. –activated sequence), ISRE (P2110, interferon-stimulated response element), AP1 (P2125, activator protein 1), NFAT (P2115, nuclear factor of activated T cells) and NF k B (P2120, binding sites
www.biomyx.net/Tech-Data-Manuals.htm |
biovision --- Microsoft Word - 3502 Phospho-c-Jun pAb-image.doc
BioVision rev. 09/05 For research use only Phospho-c-Jun (Ser73) Polyclonal Antibody RELATED PRODUCTS: Apoptosis Detection Kits Reagents ·
www.biovision.com/pdf/3502.pdf more from same supplier |
leica
and therapeutics; Antibody transport across biological barriers; Exploiting .. 22 Jun 2008 .. 25 Jun 2008
www.leica-microsystems.com/marketing/mtool.nsf/GlobalEventsByUNID/33615827658AA07780257401 ... |
abnova
Privette LM, Petty EM. et al. Cancer Res. 2007 Jun 27; [Epub ahead of print] .. Abnova product used: CHFR monoclonal antibody (M01), clone 1H3-A12
www.abnova.com.tw/newspaper/960724/index.htm more from same supplier |
ab
Natural and Medical Sciences Institute (NMI) receive BMBF-promotion for Kinome-project .. Jun 17, 2005ASK-chip shall enable targeted functional analysis of the human kinome .. Martinsried/Munich, Freiburg and Reutlingen, June 17, 2005
www.ab-direct.com/about/news-release-551.html |
invitrogen
J. Biol. Chem., Jun 2005; 10.1074/ jbc.M505513200. 9. .. Signal Enhances Nuclear Transport of Human Cytomegalovirus ppUL44.
www.invitrogen.com/downloads/GatewayCitation2005.pdf more from same supplier |
axxora
Forkhead Box [FOX] Proteins/Related Products .. - Fos & Jun Proteins/Related Products .. - General Transcription Factors [GTFs]/Related Products
www.axxora.com/transcription_factors-related_products/opfa.50.1.1361.1.1.html |
glenres
2 dec. 1999 gr12.1 jul. 1998 gr11.1 dec. 1997 gr10.1 dec. 1996 gr9.1 dec. 1995 gr8.2 jun. 1995 gr8.1 sep. 1994 gr7.1 dec. 1993 gr6.2 may. 1993 gr6.1 .. volume 19 number 1 contents modified rna phosphoramidites useful in sirna
www.glenres.com/GlenReports/GR19-1CONT.html more from same supplier |
biogenesis
Natural and Medical Sciences Institute (NMI) receive BMBF-promotion for Kinome-project .. Jun 17, 2005ASK-chip shall enable targeted functional analysis of the human kinome .. Martinsried/Munich, Freiburg and Reutlingen, June 17, 2005
www.biogenesis.co.uk/about/news-release-551.html |
immunologicalsdirect
Natural and Medical Sciences Institute (NMI) receive BMBF-promotion for Kinome-project .. Jun 17, 2005ASK-chip shall enable targeted functional analysis of the human kinome .. Martinsried/Munich, Freiburg and Reutlingen, June 17, 2005
www.immunologicalsdirect.com/about/news-release-551.html |
systembio
pTRF1-AP1-dscGFP .. (GGTGTAA)6 .. c-Jun
www.systembio.com/Transcriptional_Reporter_List.htm |
tebu
b>ap1 (mapk-ap1) .. nfat (pkc/ca++)
www.tebu-bio.com/file/news/110/index.html?printpage=1 more from same supplier |
atcc
2004 Sep 15;104(6):1648-55. Epub 2004 Jun 03. 15178579 .. Carotta S, Pilat S, Mairhofer A, Schmidt U, Dolznig H, Steinlein P, Beu H.
www.atcc.org/common/catalog/cellBiology/stemcells/publications/2004.cfm |
gentaur
b>jun ref sr1026 .. junb ref sr1027
www.gentaur.com/acatalog/Catalog_Transilent_siRNA_Vectors_67.html more from same supplier |
genepharma
You Wang, Jiangying Liu, Hong Zhao, Wenqing Lu,Jun Zhao et.al. .. Biochimica et Biophysica Acta 1773(2007)863-868
www.genepharma.com/chinese/geneshow.asp?id=14 |
mwg
Analysis of cell-type-specific gene expression during mouse spermatogenesis. .. Biol Reprod. 2004 Jun;70(6):1751-61. .. Ostergaard M, Olesen LH, Hasle H, Kjeldsen E, Hokland P.
www.mwg-biotech.com/html/s_synthesis/s_reference.shtml |
biochain
Yoshiyuki Mochida, Duenpim Parisuthiman, Masaru Kaku, Jun-ichi Hanai, Vikas P. Sukhatme, and Mitsuo Yamauchi .. The PCR primers used for RAD51AP1 were AP1-5: 5GATGACAAGCTCTACCAGAGAGAC3 and....
www.biochain.com/biochain/Technical Resources/Ref_cDNA.htm |
invivogen
20 Sept 2007: New genes : hCCR5, h mCCR9, hCCR10, hCCRL2, hCXCR5 (BRL1), hCXCR6. .. 6 Jun 2007: New genes : h mCCR1, h mCCR2, mCCR3, h mCCR4, h mCCR6, h mCCR7, h mCCR8, h mCCBP2, .. 22 May 2007: TLR4 Reporter Cell Lines (MEF HEK293).
www.invivogen.com/ressource.php?ID=7 |
mirusbio
Year: 1999 .. Article: JSAP1, a Novel Jun N-Terminal Protein Kinase (JNK)-Binding Protein That Functions as a Scaffold Factor in .. Journal: Mol. Cell. Biol.
www.mirusbio.com/products/techresources/citation-details.asp?Product=TransIT-LT1&ID=1005 |
peprotech
Journal of Immunology. 2005 Jun 1;174(11):7111-22. .. Ex vivo culture of Fancc-/- stem/progenitor cells predisposes cells to undergo apoptosis,
www.peprotech.com/articles.asp?category_name=Murine+&+Rat+Growth+Factors+&+Cytokines(Pepro ... |
discoverx
2006 Jun;4(3):263-72 .. Drug Discovery: Versatile Tag for Cell-Based Screening, Genetic Engineering News.
www.discoverx.com/august.06_DRx_newsletter.html |
clontech
Emilie Louvet, Henriette Roberte Jun ra, Isabelle Berthuy, and Dani le Hernandez-Verdun .. Compartmentation of the Nucleolar Processing Proteins in the Granular Component is a CK2-
www.clontech.com/products/detail.asp?product_id=10431&research_area_id=153055&research_sub ... more from same supplier |