| Webpages from suppliers (information here can not be filtred).
|
cellsignal --- acc acc 1 acc 2 acc-1 acc-2 acc-alpha acc-beta acc1 acc2 acca accb acetyl-co-a-carboxylase ...
Background .. Acetyl-CoA carboxylase (ACC) catalyzes the pivotal step of the fatty acid synthesis pathway. .. Ruderman, N.B. et al. (1999) Am. J. Physiol. 276, E1-E18.
www.cellsignal.com/products/1062.html more from same supplier |
abnova --- ACACA Pre-design Chimera RNAi-Abnova Corporation
ACACA monoclonal antibody (M01), clone 6H5 .. ACACA Pre-design Chimera RNAi .. ACAC, ACC, ACC1, ACCA .. Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system.
www.abnova.com.tw/product_search/PS_detail_RNAi.asp?catalog_id=H00000031-R02&category=Othe ... more from same supplier |
caltagmedsystems
Anti-TRPV2 (extracellular) - Pur.Ab (0.2 ml) .. Product Code: ACC-039B .. Anti-TRPV4 - Pur.Ab. (50µl)
www.caltagmedsystems.co.uk/pricing_ordering/products_ordering.php?CS_ID=7&CG_ID=6&numrecs= ... more from same supplier |
alomone
b>ACC-019 .. Peptide(C) RIGL LGHPP HMNVN PQQPA corresponding to residues 2732-2750 of rat IP3R1 (
www.alomone.com/p_postcards/database/32.htm |
evrogen
TGA.TCC.CGG.AAG.ATC.TCG.AGC.TCA.AGC.TTC.GTC.GAC.GGT.ACC.GCC.CGG. .. Location of features: PCMV IE: 1 589 Enhancer region: 59 465; TATA box: 554 560;
www.evrogen.com/products/RNAi-test-vector/p2FP-RNAi.pdf |
molecula
Gene acc. no. Entrez: X 03444 .. Target sequence AACTGGACTTCCAGAAGAACA
www.molecula.com/siRNA_library/laminac.html more from same supplier |
invivogen
C T T C GAAGAC T T TT TG GAGCT T EM7- peptide CCA TGGAGCCAGAAG C T TC TGAC C TCGAA Acc 65I Bbs I Bbs I Hind III · Examples of complementary oligonucleotides - if using Bbs I / .. XbaI (3510) HindIII (3505) PstI (6) BbsI (3497) SpeI (243) AgeI (312) NcoI (3237) AseI (
www.invivogen.com/sequence/psiRNA-hH1hygro_Kit_prot.pdf more from same supplier |
biocat
Clone Query .. Gene Symbol, Acc#, ID .. BLAST Search
www.biocat.de/cgi-bin/adm/sub1.pl?main_group=tissue_related&sub1=dog more from same supplier |
openbiosystems
sanger.ac.uk/cgi-bin/sequences/mirna_entry.pl?acc=MI0000739) .. Tracking microRNA expression with turboRFP
www.openbiosystems.com/RNAi/miR-expressLentiviralmicroRNA/miR-expressTechnicalDetails/inde ... |
genlantis
enzymes that do not cut Aos I 1 3444 the pGSH1-GFP vector ApaL I 1 4946 Aqu I 1 837 Acc III, Acc65 I, AccB 7 I, Age I, Aor51H I, Apa Ava I 1 837 I, Asc I, Asp 718, Asp EI, As .. GeneSilencer® pGSH1-GFP shRNA Vector (Cat # P100300) Restriction Enzyme Digestion
www.genlantis.com/objects/catalog/product/extras/1123_GeneSilencer_pGSH1GFP_RE_Table.pdf more from same supplier |
biolynx
La trousse d invasion cellulaire endoth liale a t cr e pour acc l rer le criblage des compos s qui influencent la digestion cellulaire endoth liale .. Greiner Bio-One - Plaques ThinCert
www.biolynx.ca/francais/e-lynx_mar08fr.htm |
gentaur
b>ACC-019 .. IP3R1, Anti-Rat
www.gentaur.com/i_anti-.htm |
genepharma
2. Target gene information (GeneBank Acc, GeneID, key word) .. 3. Primer design region (full sequence, 5 ' end sequence, 3 ' end sequence)
www.genepharma.com/Product.asp?id=14 more from same supplier |
panomics
Vimentin .. Acaca .. Acetyl-Coenzyme A carboxylase alpha
www.panomics.com/index.php?id=qg2psc&page=72 more from same supplier |
eurogentec
r alis es par ces soci t s pour des travaux R D confi s EUROGENTEC pourront donner acc s au cr dit d'imp t en faveur de la recherche (CIR). .. Pour plus d'information : http://www.recherche.gouv.fr/technologie/mesur/cir/index.htm
www.eurogentec.com/news/1-eurogentec-s-a-a-rec-u-l-agre-ment-cir-du-ministe-re-de-le-gue-a ... |
abcysonline
loi n° 78-17 du 6 janvier 1978 ("informatique et libertés"), vous disposez d'un droit d'accčs aux informations qui vous concernent et vous pouvez les faire modifier.
www.abcysonline.com/MyCatalogue.asp |