| Webpages from suppliers (information here can not be filtred).
|
origene --- Homo sapiens replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 2 as 1 ...
Homo sapiens replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 2 as 10 ug transfection-ready DNA NM_002914.3 .. HuSH 29mer shRNA Constructs against RFC2
www.origene.com/cdna/trueclone/accession/NM_002914/SC118345.aspx more from same supplier |
novusbio
novusbio.com Novus Team RFC2 :: Goat Polyclonal anti-RFC2 .. http://www.novusbio.
www.novusbio.com/rss/index/NB100-229/index.html more from same supplier |
bethyl --- RFC2 Antibody AbVantageâ„¢ Pack Bethyl Laboratories
A-Z / RFC2 / RFC2 Antibody AbVantageâ„¢ Pack .. RFC2 Antibody AbVantageâ„¢ Pack .. RFC2 Antibody AbVantageâ„¢ Pack
www.bethyl.com/go/index.html?product%2FA310-037A%2FTreeKey=8f3b3d62-117a-4203-90c8-53a1bf4 ... more from same supplier |
natutec --- RFC2 Antibody AbVantage Pack
LD50 oral mouse - 27 mg/kg. .. RFC2 Antibody AbVantageTM Pack Affinity Purified Catalog No. .. RFC2 Antibody (BL275G) Affinity Purified Anti-RFC2 antibody, anti-RFC40
www.natutec.de/pdf_bethyl/A310-037A.pdf more from same supplier |
ptglab --- Antibody to RFC2
Purified Rabbit Anti Human RFC2 Polyclonal antibody .. If your publishing research used Anti-RFC2, please let us know so that we can cite the
www.ptglab.com/datasheet.asp?catNo=10410-1-AP&Promotion=free more from same supplier |
caltagmedsystems --- Mouse anti Human RFC2 polyclonal antibody (A01) - Caltag Medsystems
Product Details Mouse anti Human RFC2 polyclonal antibody (A01) .. Further information: Antigen - RFC2 - replication factor C (activator 1) 2 - 40kDa
www.caltagmedsystems.co.uk/pricing_ordering/product_detail.php?CI_ID=148023 more from same supplier |
abnova
b>RFC2 polyclonal antibody (A01) .. Mouse polyclonal antibody raised against a partial recombinant RFC2.
www.abnova.com/Products/products_list.asp?classid=AEABAC000000&OwnClass=3&ClassL1=A&ClassL ... more from same supplier |
orbigen
Replication factor C p40 (RFC2) .. BVC-10093
www.orbigen.com/commerce/catalog/product.jsp?product_id=1085 |
abnova
OAS1 / ORC4L / OVOL2 / PB1 / POLE / POLE3 / PRKRIR / RAD1 / RAD51L1 / RBBP6 / RBMS1 / RFC2 / RFC3 / RFC4 / RPA2 / RPL29 / SIRT2 / SIRT3 / SNRPA / SSX2 / TIA1 / TREX1 / WHSC1L1 / .. - Cell Adhesion/Junction/Cytoskeleton (11) : Â BYSL / CCL11 / CD33 / CD97 / EFS / FEZ1 /
www.abnova.com.tw/newspaper/970204/index_3.html |
tebu
OAS1 / ORC4L / OVOL2 / PB1 / POLE / POLE3 / PRKRIR / RAD1 / RAD51L1 / RBBP6 / RBMS1 / RFC2 / RFC3 / RFC4 / RPA2 / RPL29 / SIRT2 / SIRT3 / SNRPA / SSX2 / TIA1 / TREX1 / WHSC1L1 / .. Cell Adhesion/Junction/Cytoskeleton (11) : BYSL / CCL11 / CD33 / CD97 / EFS / FEZ1 /
www.tebu-bio.com/file/news/96/index.html?printpage=1 more from same supplier |
invivogen
3501 CGGGAAGCGTGGCGCTTTCTCAT .. pFUSE-rFc2 (IL2ss) Plasmid designed for the construction of Fc-Fusion proteins Catalog # pfuse- .. SgfI (6) PvuI (7) PvuII (239) NotI (4015) HindIII (245) SwaI (4005) Bsu36I (291) PacI (
www.invivogen.com/PDF/pFUSE-rFc2_TDS_2.pdf |
lsbio
3-phosphate dehydrogenase, replication factor c 40 kd subunit, rf-c 40 kd subunit, rfc2, rfc40
www.lsbio.com/products/GeneDetail.aspx?LSID=253 more from same supplier |
cedarlanelabs
b>RFC2 Recombinant Protein (Q01) .. RFC2 Recombinant Protein (Q01)
www.cedarlanelabs.com/US/abnova.asp?action=browse&cid=64&page=28 |
medicorp
pfuse-rfc2 .. Description: pFUSE-rIgG-Fc2 (20 µg)
www.medicorp.com/web/suppliers.php?supplier=Invivogen&sup=Invivogen&p_cat=0&page=16&lang=e ... more from same supplier |
genwaybio
Subunit: Part of a DNA-binding complex containing RFC2, RFC3, RFC4 and RFC5. Interacts with RAD1 and RAD9 within the RAD1-RAD9-HUS1 complex. .. Subcellular Location: Nucleus.
www.genwaybio.com/product_info.php?products_id=191748 more from same supplier |